MESSAGE BOARDS

This is the message boards forums for the International Myotonic Dystrophy Organization. This site is for members and others to read and post information about Myotonic Dystrophy. Please help us by posting information about the disease that you are aware of. You will need to do a simple registration process that will prevent spammers from posting on the site only if you want to post. No registration is required for reading. Whether you are viewing or posting we thank for all your help. The main organization website is http://www.myotonicdystrophy.org You may also want to view the guestbook as there is some good information there. http://www.theguestbook.com/read.php/613431

A Message Board, Guestbook, or Poll hosted for your website.
Intl Myotonic Bulletin Board

Register Login Chat
International Myotonic Dystrophy Organization > Message Board > question on repeat counts for DM2
 
Username:
Password:
 

Thread Tools  | Search This Thread 
Reply
 
Author Comment
 
klpatrick
Junior Member
Registered: 05/27/09
Posts: 3

Contact using Yahoo

    05/27/09 at 12:55 AM
Reply with quote#1

Hi, My husband was tested through Athena diagnosics twice for Myotonic Dystrohpy Tpye 1 and 2 (not enough DNA the first time). Tpe 1 came back degative, Type 2 came back inconclusive. He was restesed and came back with the same repeats - 132 and 134 which according to their scale is normal . However, looking online other websites have a lower reading that would show him as a positive. He has myotonia, low testosterone, muscle cramps, definate calve cramps, daytime sleepiness, and I very stubborn.  Anohther site says reading would be positive evern though Athena says negative, we're not sure where to go from here.
Has anyone else been through the numbers games?
Any info. is helfpful.
Thanks,
Kris Patrick

__________________
Krist Patrick
alidukes
Registered: 06/28/09
Posts: 1

    06/28/09 at 12:54 AM
Reply with quote#2

I'm not sure who gave you your information that your husband is negative. I have repeats of 140 and was diagnosed with DM1. I was told by my laboratory and confirmed by neurologist that any repeats over 100 is considered full expansion of the disease/disorder (DM1).

klpatrick
Junior Member
Registered: 05/27/09
Posts: 3

Contact using Yahoo

    06/28/09 at 08:43 PM
Reply with quote#3

Thanks for your reply, he is seeing his nerologist in July and we will ask him about it again, or ask for a second opinion.
I don't know if the repeats are different for MMD1 and MMD2, but I think it bears looking into.
Best of luck to you
Kris

__________________
Krist Patrick
dmchat
Super Member
Registered: 05/01/07
Posts: 71

    06/30/09 at 04:10 AM
Reply with quote#4

Message Mmaxx, she know more about this than anyone I know.


__________________
Simon
RPittsley
Super Member
Registered: 07/03/08
Posts: 26

    07/06/09 at 01:21 PM
Reply with quote#5

I was tested 14 years ago.  My repeat is 87.  I was told at that time that I am "positive."  I have a sister who's repeat is 94 and my father's is 87.  They were both told that they were positive.  My sister with the 94 repeat has almost as many problems as the two sisters that are disabled with 250 repeats each.  I am on the minor end of the scale but still have problems with psychiatric issues (depression), gastrointestinal and endocrine problems as well as muscle cramping.  The information that I received at the time of my diagnosis is that you either have it or you don't and that repeats do not always indicate severity of symptoms.

Rachelle
klpatrick
Junior Member
Registered: 05/27/09
Posts: 3

Contact using Yahoo

    07/07/09 at 10:59 PM
Reply with quote#6

Rachelle,
Do you have DM1 or DM2? I don't know if the counts for the different types are different. Thanks so much for your reply, it helps to know that other people read the posts and reply. It's so frustrating, I hope when he goes back to the doctor in late July we get some answers!
Kris

__________________
Krist Patrick
RPittsley
Super Member
Registered: 07/03/08
Posts: 26

    07/13/09 at 02:09 PM
Reply with quote#7

I have DM1.  From what I have read, the CTG count for DM1 and CCTG count for DM2 are done in a pretty similar manner. 

I find it interesting that some people are told that the tests are inconclusive, or that their gene count is "around" a certain number.  It seems that this would be something they could be pretty concrete about.  When they gave me my twin girls' count they were very concise.  I also have identical twin sisters whose counts are 10 points different.  They said they think that occured because one implanted in the uterus slightly ahead of the other.  This would then seem to lend itself to the possiblity that replication stops upon uterine implantation.  I haven't seen any studies on it though.
Carol
Senior Member
Registered: 08/25/07
Posts: 14

    07/14/09 at 02:40 PM
Reply with quote#8

Does anyone know if the numbers are different in the US and Canada? My kids have 1000 repeats. How can that be? We live in Canada. I know there's a differnce when we check blood levels and other results.

RPittsley
Super Member
Registered: 07/03/08
Posts: 26

    07/14/09 at 02:47 PM
Reply with quote#9

I live in the US.  My nephew had 1100 repeats.  My sister (his mother) told me that she had read of a man who had 8000 repeats and had no symptoms until he was in his 80's.

godoggo3
Super Member
Registered: 08/31/07
Posts: 43

    08/04/09 at 05:47 AM
Reply with quote#10

The Athena site identifies 177 as the number above which is abnormal. Here is a link to the site and information on Athena:

http://www.athenadiagnostics.com/content/test-catalog/find-test/service-detail/q/id/195

                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
Technical Information

Utility:Detects CCTG repeat expansions in the Zinc Finger Protein 9 (ZNF9) gene

Methodology:Polymerase Chain Reaction (PCR), Fragment analysis and Southern blot

Reference Value:Normal: Less than 177 base pairs

CPT Code(s):83891(1), 83898(1), 83909(1), 83912(1)

Patents:6,902,896


However on the NCBI site There is information that some individuals have been identified with ranges below this of 177:

Liquori et al. (2001) reported that DM2 is caused by a CCTG expansion located in intron 1 of the ZNF9 gene (116955.0001). Expanded allele sizes ranged from 75 to approximately 11,000 CCTG repeats, with a mean of approximately 5,000 repeats. Expansion sizes in the blood of affected children were usually shorter than in their parents (reverse anticipation), but the authors noted that the time-dependent somatic variation of repeat size may complicate interpretation of this difference. No significant correlation between the age of onset and expansion size was observed



__________________
This is a disease that will be conquered one day!!
godoggo3
Super Member
Registered: 08/31/07
Posts: 43

    08/04/09 at 06:03 AM
Reply with quote#11

Here is some background information on US Patent # 6902896. The use of patents is very useful to increase the interest of researchers in going into an area. It does increase the cost of testing. I had my sons test done at Baylor University for DM1. This test was not patented for DM1. We will try and find more information this subject.

       
United States Patent 6,902,896
Ranum ,   et al. June 7, 2005

Intron associated with myotonic dystrophy type 2 and methods of use

Abstract

The present invention provides methods for identifying individuals not at risk for developing myotonic dystrophy type 2 (DM2), and individuals that have or are at risk for developing DM2. The present invention also provides isolated polynucleotides that include a repeat tract within intron 1 of the zinc finger protein 9.


Inventors: Ranum; Laura P. W. (St. Paul, MN), Day; John W. (Minneapolis, MN), Liquori; Christina (Minneapolis, MN)
Assignee: Regents of the University of Minnesota (Minneapolis, MN)
Appl. No.: 10/143,266
Filed: May 10, 2002

Current U.S. Class: 435/6 ; 435/91.1; 435/91.2; 536/23.1; 536/24.3; 536/24.31; 536/24.33
Current International Class: C07K 14/435 (20060101); C12Q 1/68 (20060101); C07K 14/47 (20060101); C12Q 001/68 (); C07H 021/04 ()
Field of Search: 435/6,91.1,91.2 536/23.1,24.3,24.31,24.33,24.32


References Cited [Referenced By]

Foreign Patent Documents







01/72799
Oct., 2001
WO


Other References



Primary Examiner: Wilder; Cynthia
Attorney, Agent or Firm: Mueting Raasch & Gebhardt, P.A.

Government Interests



GOVERNMENT FUNDING

The present invention was made with government support under Grant Number NS35870, awarded by the National Institutes of Health. The Government has certain rights in this invention.
Parent Case Text



CONTINUING APPLICATION DATA

This application claims the benefit of U.S. Provisional Application Ser. No. 60/290,365, filed May 11, 2001, U.S. Provisional Application Ser. No. 60/302,022, filed Jun. 29, 2001, and U.S. Provisional Application Ser. No. 60/337,831, filed Nov. 13, 2001, which are incorporated by reference herein.
Claims



What is claimed is:

1. A method for detecting a polynucleotide comprising a repeat tract within an intron 1 of a zinc finger protein 9 (ZNF9) genomic sequence, the method comprising: amplifying nucleotides of an intron 1 region of a ZNF9 genomic sequence to form amplified polynucleotides, wherein the amplified polynucleotides comprise repeat tracts; and detecting the amplified polynucleotides.

2. A method for detecting a polynucleotide comprising a repeat tract within an intron 1 of a ZNF9 genomic sequence, the method comprising: digesting genomic DNA with a restriction endonuclease to obtain polynucleotides; probing the polynucleotides under hybridizing conditions with a detectably labeled probe which hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence; and detecting the probe which has hybridized to the polynucleotides.

3. A method for identifying an individual not at risk for developing myotonic dystrophy type 2 (DM2), the method comprising: analyzing intron 1 regions of ZNF9 genomic sequences of an individual for two not at risk alleles comprising repeat tracts of no greater than about 176 nucleotides, wherein an individual comprising two alleles comprising repeat tracts of no greater than about 176 nucleotides is not at risk for developing DM2.

4. A method for identifying an individual not at risk for developing DM2, the method comprising: amplifying nucleotides of intron 1 regions of ZNF9 genomic sequences of an individual to form amplified polynucleotides, wherein the amplified polynucleotides comprise repeat tracts; comparing the size of the amplified polynucleotides; and analyzing the amplified polynucleotides for two not at risk alleles wherein an individual comprising two not at risk alleles is not at risk for developing DM2.

5. The method of claim 4 wherein amplifying comprises: performing a polymerase chain reaction (PCR) with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO: 1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-18661 of SEQ ID NO:1.

6. A method for identifying an individual not at risk for developing DM2, the method comprising: amplifying nucleotides of intron 1 regions within ZNF9 genomic sequences of an individual to form amplified polynucleotides, wherein the amplified polynucleotides comprise repeat tracts; and analyzing the repeat tracts of the amplified polynucleotides for two not at risk alleles comprising repeat tracts of no greater than about 176 nucleotides, wherein an individual comprising two alleles comprising repeat tracts of no greater than about 176 nucleotides is not at risk for developing DM2.

7. A method for identifying an individual that has DM2 or is at risk for developing DM2, the method comprising: analyzing an intron 1 region of a ZNF9 genomic sequence of an individual for one at risk allele comprising a repeat tract comprising at least about 75 CCTG repeats wherein an individual comprising one allele comnrising a repeat tract of at least about 75 CCTG repeats has DM2 or is at risk for developing DM2.

8. A method for identifying an individual that has DM2 or is at risk for developing DM2, the method comprising: digesting genomic DNA of an individual with a restriction endonuclease to obtain polynucleotides; probing the polynucleotides under hybridizing conditions with a detectably labeled probe that hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence; detecting the probe that has hybridized to the polynucleotide; and analyzing the intron 1 region of the hybridized polynucleotide for one at risk allele comprising a repeat tract comprising at least about 75 CCTG repeats, wherein an individual comprising one allele comprising a repeat tract of at least about 75 CCTG repeats has DM2 or is at risk for developing DM2.

9. The method of claim 8 wherein the probe comprises at least about 200 consecutive nucleotides from SEQ ID NO: 1, or the complement of the at least 200 concecutive nucleotides from SEQ ID NO:1.

10. A method for identifying an individual that has or is at risk for developing DM2, the method comprising: amplifying nucleotides of an intron 1 region of a ZNF9 genomic sequence of an individual to form amplified polynucleotides, wherein the amplified polynucleotides comprise a repeat tract; and analyzing the repeat tracts of the amplified polynucleotides for one at risk allele comprising a repeat tract comprising at least about 75 CCTG repeats, wherein an individual comprising one at risk allele comnrising a repeat tract of at least about 75 CCTG reoeats has or is at risk for develoDing DM2.

11. The method of claim 10 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer flanks the CCTG repeat tract located within the intron 1 region, the first primer comprising at least about 15 nucleotides selected from nucleotides 4469 15701-17701 of SEQ ID NQ:1 or nucleotides 17858-18661 of SEQ ID NO:1, and the second primer comprising a nucleotide sequence that hybridizes to the CCTG repeat tract.

12. The method of claim 1 wherein detecting comprises detecting amplified polynucleotides comprising a repeat tract of no greater than about 176 nucleotides.

13. The method of claim 1 wherein detecting comprises detecting amplified polynucleotides comprising a repeat tract comprising at least about 75 CCTG repeats.

14. The method of claim 1 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-19858 of SEQ ID NO: 1.

15. The method of claim 14 wherein the first primer comprises GGCCTTATAACCATGCAAATG (SEQ ID NO:11) and the second primer comprises GCCTAGGGGACAAAGTGAGA (SEQ ID NO:10).

16. The method of claim 1 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer flanks a CCTG repeat tract located within the intron 1 region, the first primer comprising at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1 or nucleotides 17858-18661 of SEQ ID NO:1, and the second primer comprising a nucleotide sequence that hybridizes to the CCTG repeat tract.

17. The method of claim 1 wherein amplifying comprises: performing a PCR with a first primer comprising GGCCTTTATAACCATGCAAATG (SEQ ID NO:11), a second primer comprising TACGCATCCGAGTTTGAGACGCAGGCAGGCAGGCAGGCAGG (SEQ ID NO:36), and a third primer comprising TACGCATCCGAGTTTGAGACG (SEQ ID NO:37).

18. The method of claim 1 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer flanks a CCTG repeat tract located within the intron 1 region, the first primer comprising at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1 or nucleotides 17858-19858 of SEQ ID NO:1, and the second primer comprising a nucleotide sequence that hybridizes to the CCTG repeat tract.

19. The method of claim 2 wherein the probe comprises at least about 200 consecutive nucleotides from SEQ ID NO: 1, or the complement of the at least 200 consective nucleotides from SEQ ID NO: 1.

20. The method of claim 2 wherein the probe comprises TTGGACTTGQAATGAGTGAATG (SEQ ID NO:38) or nucleotides 16507-16992 of SEQ ID NO:1.

21. The method of claim 4 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-19858 of SEQ ID NO:1.

22. The method of claim 21 wherein the first primer comprises GGCCTTATAACCATGCAAATG (SEQ ID NO: 11) and the second primer comprises GCCTAGGGGACAAAGTGAGA (SEQ ID NO:10).

23. The method of claim 6 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-19858 of SEQ ID NO:1.

24. The method of claim 23 wherein the first primer comprises GGCCTTATAACCATGCAAATG (SEQ ID NO:11) and the second primer comprises GCCTAGGGGACAAAGTGAGA (SEQ ID NO:10).

25. The method of claim 6 wherein amplifying comprises: performing a polymerase chain reaction (PCR) with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-18661 of SEQ ID NO: 1.

26. The method of claim 8 wherein the probe comprises TTGGACTTGGAATGAGTGAATG (SEQ ID NO:38) or nucleotides 16507-16992 of SEQ ID NO:1.

27. The method of claim 10 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer flanks the CCTG repeat tract located within the intron 1 region, the first primer comprising at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1 ornucleotides 17858-19858 of SEQ ID NO:1, and the second primer comprising a nucleotide sequence that hybridizes to the CCTG repeat tract.

28. The method of claim 10 wherein amplifying comprises: performing a PCR with a first primer comprising GGCCTTATAACCATGCAAATG (SEQ ID NO:11), a second primer comprises TACGCATCCGAGTTTGAGACGCAGGCAGGCAGGCAGGCAGG (SEQ ID NO:36), and a third primer comprising TACGCATCCGAGTTTGAGACG (SEQ ID NO:37).

29. A method for identifying an individual not at risk for developing DM2, the method comprising: amplifying nucleotides of intron 1 regions of ZNF9 genomic sequences of an individual to form amplified polynucleotides, wherein the amplified polynucleotides comprise repeat tracts; and comparing the size of the amplified polynucleotides, wherein the presence of two amplified polynucleotides indicates the individual is not at risk for developing DM2.

30. A method for identifying an individual that has DM2 or is at risk for developing DM2, the method comprising: providing a tissue sample from an individual; probing the tissue sample under hybridizing conditions with a detectably labeled probe which hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence; detecting the probe which has hybridized to polynucleotides present in the tissue sample; and observing nuclei of cells present in the tissue sample, wherein the presence of the detectably labeled probe in nuclei of the cells indicates the individual has or is at risk for developing DM2.

31. The method of claim 30 wherein the probe comprises (CAGG).sub.n, where n is at least 4.

32. A method for identifying an individual that is not at risk for developing DM2, the method comprising: providing a tissue sample from an individual; probing the tissue sample under hybridizing conditions with a detectably labeled probe which hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence; detecting the probe which has hybridized to polynucleotides present in the tissue sample; and observing nuclei of cells present in the tissue sample, wherein the absence of the detectably labeled probe in nuclei of the cells indicates the individual is not at risk for developing DM2.

33. The method of claim 32 wherein the probe comprises (CAGG).sub.n, where n is at least 4.
Description



BACKGROUND

DM is a dominantly-inherited, multisystemic disease with a consistent constellation of seemingly unrelated and rare clinical features including: myotonia, muscular dystrophy, cardiac conduction defects, posterior iridescent cataracts, and endocrine disorders (Harper, Myotonic Dystrophy, W. B. Saunders, London, ed. 2, 1989)). DM was first described nearly 100 years ago, but the existence of more than one genetic cause was only recognized after genetic testing became available for myotonic dystrophy type 1 (DM1) (Thornton et al., Ann. Neurology, 35, 269 (1994), Ricker et al., Neurology, 44, 1448 (1994)).

DM1 is caused by an expanded CTG repeat on chromosome 19 that is both in the 3' untranslated region of the dystrophia myotonica-protein kinase (DMPK) gene, and in the promoter region of the immediately adjacent homeodomain gene SIX5 (Groenen and Wieringa, Bioessays, 20, 901 (1998), Tapscott, Science, 289, 1701 (2000)). How the CTG expansion in a noncoding region of a gene causes the complex DM phenotype remains unclear. Suggested mechanisms include: (i) haploinsufficiency of the DMPK protein; (ii) altered expression of neighboring genes, including SIX5; and (iii) pathogenic effects of the CUG expansion in RNA which accumulates as nuclear foci and disrupts cellular function. Several mouse models have developed different aspects of DM1: a model expressing mRNA with CUG repeats manifests myotonia and the myopathic features of DM1; a DMPK knockout has cardiac abnormalities; and SIX5 knockouts have cataracts. Taken together, these data have been interpreted to suggest that each theory may contribute to DM1 pathogenesis and that DM1 may be a regional gene disorder.

To better define the pathophysiological cause of DM, we have studied families with many of the clinical features of DM but without the DM1 CTG expansion. After genetic testing became available for DM1, families with DM2 and Proximal Myotonic Myopathy (PROMM) were identified and linkage analysis excluded involvement of the DM1 locus, as well as excluding the muscle chloride and sodium channel genes. Proximal Myotonic Dystrophy (PDM) and Myotonic Dystrophy type 2 (DM2) were subsequently described, broadening the recognized phenotype of non-DM 1 forms of dominantly inherited multisystemic myotonic disorders. In 1998 the DM2 locus was mapped to 3q21, and it was demonstrated that the genetic cause of PROMM map to the same locus in many families.

Defining a second human mutation that causes the multisystemic effects of DM, and identifying what is common to these diseases at the molecular level, provides an independent means of determining the pathogenic pathway of DM and allow methods for diagnosing this disease to be developed.

SUMMARY OF THE INVENTION

The present invention represents an advance in the art of detecting whether a human individual is at risk for myotonic dystrophy type 2 (DM2). The inventors have discovered that DM2 is caused by a CCTG expansion in intron 1 of the nucleotides encoding zinc finger protein 9 (ZNF9). This expansion is located in a region of the genome for which the nucleotide sequence was not completely ordered prior to the present invention. The correct sequence of this region has been determined and is disclosed herein. Accordingly, the present invention provides isolated polynucleotides. The polynucleotides include a nucleotide sequence of about nucleotides 1-14468 of SEQ ID NO:1, about nucleotides 14474-22400 of SEQ ID NO:1, about nucleotides 17501-17701 of SEQ ID NO:1, about nucleotides 17501-17701 of SEQ ID NO:1 and a repeat tract, about nucleotides 17858-18058 of SEQ ID NO:1, a repeat tract and about nucleotides 17858-18058 of SEQ ID NO:1, or the complements thereof. The present invention also provides isolated polynucleotides that include at least about 15 consecutive nucleotides from nucleotides 16701-17701 of SEQ ID NO:1, at least about 15 consecutive nucleotides from nucleotides 17858-18862 of SEQ ID NO:1, or the complements thereof.

The present invention provides a method for detecting a polynucleotide that includes a repeat tract within an intron 1 of a zinc finger protein 9 (ZNF9) genomic sequence. The method includes amplifying nucleotides of an intron 1 region of a ZNF9 genomic sequence to form amplified polynucleotides, wherein the amplified polynucleotides includes repeat tracts, and detecting the amplified polynucleotides. Alternatively, the method includes digesting genomic DNA with a restriction endonuclease to obtain polynucleotides, probing the polynucleotides under hybridizing conditions with a detectably labeled probe which hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence, and detecting the probe which has hybridized to the polynucleotides.

The present invention further provides a method for identifying an individual not at risk for developing myotonic dystrophy type 2 (DM2). The method includes analyzing intron 1 regions of ZNF9 genomic sequences of an individual for two not at risk alleles that include repeat tracts of no greater than 176 nucleotides. For instance, the method may include amplifying nucleotides of intron 1 regions of ZNF9 genomic sequences of an individual to form amplified polynucleotides, wherein the amplified polynucleotides include repeat tracts, comparing the size of the amplified polynucleotides, and analyzing the amplified polynucleotides for two not at risk alleles. The act of amplifying may include performing a polymerase chain reaction (PCR) with a primer pair that includes a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions. The first primer includes at least about 15 nucleotides selected from nucleotides 14469-17701 of SEQ ID NO:1, and the second primer includes at least about 15 nucleotides selected from nucleotides 17858-18661 of SEQ ID NO: 1. Alternatively, the method may include amplifying nucleotides of intron 1 regions within ZNF9 genomic sequences of an individual to form amplified polynucleotides, wherein the amplified polynucleotides include repeat tracts, and analyzing the repeat tracts of the amplified polynucleotides for two not at risk alleles including repeat tracts of no greater than 176 nucleotides.

Also provided by the present invention is a method for identifying an individual that has DM2 or is at risk for developing DM2. The method includes analyzing an intron 1 region of a ZNF9 genomic sequence of an individual for one at risk allele including a repeat tract including at least about 75 CCTG repeats. In another aspect, the method includes digesting genomic DNA of an individual with a restriction endonuclease to obtain polynucleotides, probing the polynucleotides under hybridizing conditions with a detectably labeled probe that hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence, detecting the probe that has hybridized to the polynucleotide, and analyzing the intron 1 region of the hybridized polynucleotide for one at risk allele including a repeat tract including at least about 75 CCTG repeats. In yet another aspect, the method includes amplifying nucleotides of an intron 1 region of a ZNF9 genomic sequence of an individual to form amplified polynucleotides, wherein the amplified polynucleotides include a repeat tract, and analyzing the repeat tracts of the amplified polynucleotides for one at risk allele including a repeat tract including at least about 75 CCTG repeats.

The present invention also provides kits. In one aspect of the invention, the kit is for identifying whether an individual is not at risk for developing DM2. The kit includes a first primer having at least about 15 consecutive nucleotides selected from nucleotides 14469-17701 of SEQ ID NO:1, and the second primer having at least about 15 consecutive nucleotides selected from nucleotides 17858-18661 of SEQ ID NO:1. An individual who is not at risk has two not at risk alleles of ZNF9 genomic sequences including repeat tracts of no greater than 176 nucleotides.

In another aspect, the kit is for identifying whether an individual is at risk for developing DM2. The kit includes a probe having at least about 200 nucleotides, wherein the probe hybridizes to SEQ ID NO:1 or the complement thereof. An individual who is at risk has one at risk allele of a ZNF9 genomic sequence including a repeat tract including at least about 75 CCTG repeats. Alternatively, the kit includes a first primer having at least about 15 nucleotides selected from nucleotides 14469-17701 of SEQ ID NO:1 or nucleotides 17858-18661 of SEQ ID NO:1, and a second primer having a nucleotide sequence selected from the group consisting of (CCTG).sub.n and (CAGG).sub.n, where n is at least 4. An individual who is at risk has one at risk allele of a ZNF9 genomic sequence including a repeat tract including at least about 75 CCTG repeats.

In yet another aspect, the kit is for identifying whether an individual has DM2. The kit includes a probe having at least about 200 nucleotides, wherein the probe hybridizes to SEQ ID NO:1 or the complement thereof. An individual who is at risk has one at risk allele of a ZNF9 genomic sequence including a repeat tract including at least about 75 CCTG repeats, and displays a symptom of DM2. Alternatively, the kit includes a first primer including at least about 15 nucleotides selected from nucleotides 14469-17701 of SEQ ID NO: 1 or nucleotides 17858-18661 of SEQ ID NO: 1, and a second primer including a nucleotide sequence selected from the group consisting of (CCTG).sub.n and (CAGG).sub.n, where n is at least 4. An individual who is at risk has one at risk allele of a ZNF9 genomic sequence including a repeat tract including at least about 75 CCTG repeats.

Unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. Expanded CL3N58 allele found in DM2 patients. (A) DM2 critical region. Black represents the minimal DM2 critical region, white represents DM2 excluded regions, and grey represents regions in which recombination has occurred. Markers defining recombination events and establishing linkage disequilibrium are shown, along with previously published markers. The relative significance of the p-values are indicated by plusses above the marker names, with `++`.ltoreq.0.01, `+++`.ltoreq.0.001 `++++`.ltoreq.0.0001, and `++++++`.ltoreq.0.000001. Three BACs (orientation unknown) within the region of linkage disequilibrium are shown. Not drawn to scale. (B) Pedigrees of three different DM2-linked families, each represented by a nuclear family. (C) PCR analysis of CL3N58 marker. The genotype of each individual is shown, with the size of each allele given in basepairs below each lane. Unamplified alleles are represented by "-". (D) Southern-blot analysis of expansion mutations. Individuals with an expanded CCTG tract are represented by "EXP" and individuals with 2 normal alleles are represented by "N". The blot was also hybridized with an SCA8 loading control, showing that all but the first lane was evenly loaded. (E) High resolution sizing of expansions. Lane 3 contains DNA from a control sample. The number of CCTG's of each individual's expanded allele is shown, with "N" representing a normal length CCTG tract.

FIG. 2. Analysis of DM2 affected and normal alleles. (A) Distribution of CL3N58 alleles among controls (n=1360). Alleles represent the total basepair size of the combined TG, TCTG, and CCTG repeat tracts. (B) Schematic diagram of DM2 expansion region, showing sequence configurations of normal and expanded repeat tracts. (C) Distribution of expanded alleles among 51 affected members of six DM2 families. All expanded allele sizes were included for individuals with multiple bands and, in contrast to (B), are given in CCTG repeat units.

FIG. 3. Instability of the DM2 expansion. (A) Somatic heterogeneity in blood. Southern blots of BsoBI-digested genomic DNA from blood revealed multiple expanded alleles in some affected individuals, some discrete in size (lanes 1 &2), others broad (lane 3). (B) Southern blots of EcoRI-digested genomic DNA from blood of monozygotic twins (lanes 4 and 5). (C) Expanded alleles increase in length over time. Southern blot of EcoRI-digested genomic DNA samples from blood taken from a single patient at 28 (lane 6) and 31 (lane 7) yrs of age, respectively. (D) Correlation between the size of the expanded allele in individuals with a single allele and age at the time blood sample was taken.

FIG. 4. Genomic organization of the ZNF9 gene. The position of the DM2 expansion in intron 1 is shown. The gene spans 16.5 kb of genomic sequence with an mRNA of 1.5 kb.

FIG. 5. Northern analysis of ZNF9 RNA expression. Upper panel, human multiple-tissue northern blot hybridized a riboprobe that included exon 5 of ZNF9; lower panel, actin used as a loading control; 1.5, 2.0, 1.8, size in kilobases.

FIG. 6. (A) Schematic diagram of repeat assay PCR reaction products. (B) PCR analysis of CL3N58 marker. Lane 1, from the unaffected mother, shows two alleles. Lanes 2 and 3, from the affected father and affected son, respectively, show only one allele. There is no shared allele in lanes 2 and 3, as would be expected in normal Mendelian inheritance of PCR alleles. (C) Southern-blot analysis of expansion mutations. Lanes 1-4 show affected individuals with detectable expanded bands. Lane 5 shows an unaffected individual with only the normal-sized band. Lanes 6 and 7 show affected individuals with no detec" expansion. Lane 8 shows an affected SCA8 individual with an expanded band. (D) Repeat assay of DM2 mutations. Lanes 1-5 and 8 show affected individuals who are expansion-positive, indicated by smears above the normal allele, by the Repeat assay. Lanes 1, 2, 4, 5, and 8 show affected individuals who had expansions by Southern-blot analysis, while lane 3 shows an affected individual who had no detectable expansion by Southern-blot analysis. Lanes 6, 7, 9, and 10 show unaffected individuals who are expansion-negative, indicated by the lack of smears above the normal allele, by the Repeat assay. (E) Abbreviated pedigree of a DM2 family. Filled-in symbols represent affected individuals. Below each symbol: age of blood draw, CL3N58 PCR allele sizes (where "B" signifies evident existence of a non-amplifying blank allele), and either the size of the expansion detected by Southern ("N kb") or the result of the Repeat assay, given as Exp(+) or Exp(-), where Exp refers to expansion, for those with no expansion on southern analysis.

FIG. 7. Nucleotide sequence of a human zinc finger protein 9 (ZNF9) genomic sequence (SEQ ID NO:1). N, nucleotide A, C, T, or G.

FIG. 8. Correlation of Repeat Length with Clinical Severity.

FIG. 9. Intergenerational changes in repeat length.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION

Compositions

The present invention provides isolated polynucleotides that include a portion of an intron 1 region of a zinc finger protein 9 (ZNF9) genomic sequence. As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides, and includes both double- and single-stranded DNA and RNA. A polynucleotide may include nucleotide sequences having different functions, including, for instance, genomic sequences, and other sequences such as regulatory sequences and/or introns. A polynucleotide can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic, or chemical techniques. A polynucleotide can be linear or circular in topology. A polynucleotide can be, for example, a portion of a vector, such as an expression or cloning vector, or a fragment. An "isolated" polypeptide or polynucleotide means a polypeptide or polynucleotide that has been either removed from its natural environment, produced using recombinant techniques, or chemically or enzymatically synthesized. Preferably, a polypeptide or polynucleotide of this invention is purified, i.e., essentially free from any other polypeptide or polynucleotide and associated cellular products or other impurities. As used herein, a "genomic sequence" includes a polynucleotide that encodes an unprocessed preRNA (i.e., an RNA molecule that includes both exons and introns), and the preRNA. When placed under the control of appropriate regulatory sequences, a genomic sequence produces an mRNA. The boundaries of a genomic sequence are generally determined by a transcription initiation site at its 5' end and a transcription terminator at its 3' end. A genomic sequence typically includes introns and exons. A regulatory sequence is a polynucleotide that regulates expression of a genomic sequence to which it is operably linked. A non-limiting example of a regulatory sequence includes promoters. "Operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. A regulatory sequence is "operably linked" to a genomic sequence when it is joined in such a way that expression of the genomic sequence is achieved under conditions compatible with the regulatory sequence.

The ZNF9 genomic sequence maps to chromosome 3, position 3q21, in the human genome. The sequence tagged sites (STS) associated with the ZNF9 genomic sequence include N22238 and stG51107. The polypeptide encoded by the ZNF9 genomic sequence contains 7 zinc finger domains and functions as an RNA-binding polypeptide by binding the sterol regulatory element (see Rajavashisth et al. Science, 245, 640-643). As used herein, a "polypeptide" refers to a polymer of amino acids linked by peptide bonds and does not refer to a specific length of a polymer of amino acids. The ZNF9 genomic sequence contains 5 exons and 4 introns (see FIG. 4).

The sequence of a ZNF9 genomic sequence obtained from one individual is disclosed in FIG. 7. In this sequence, exon 1 corresponds to nucleotides 4337-4415, exon 2 corresponds to nucleotides 18662-18799, exon 3 corresponds to nucleotides 78896-18987, exon 4 corresponds to nucleotides 19156-19356, and exon 5 corresponds to nucleotides 19865-20845. Intron 1, which corresponds to nucleotides 4416-18661, includes a gap of unknown size. This gap is depicted in SEQ ID NO:1 between nucleotides 14469-14473. An intron 1 of a ZNF9 genomic sequence includes a TG/TCTG/CCTG repeat tract, which is also referred to herein as a "repeat tract." The characteristics of repeat tracts are described in greater detail below. In SEQ ID NO:1, the repeat tract corresponds to nucleotides 17702-17858. In the ZNF9 genomic sequence, the transcription initiation site is nucleotide 4337, the first nucleotide of exon 1, and the transcription termination site is nucleotide 20845.

An intron 1 of a ZNF9 genomic sequence typically includes at least about 14247 nucleotides. The sequences of an intron 1 immediately adjacent to exon 1 (i.e., the 5' end of intron 1) are preferably nucleotides 4416-4426 of SEQ ID NO:1, more preferably nucleotides 4416-4466 of SEQ ID NO:1, most preferably nucleotides 4416-4516 of SEQ ID NO:1. The sequences of an intron 1 immediately adjacent to exon 2 (i.e., the 3' end of intron 1) are preferably nucleotides 18641-18661 of SEQ ID NO:1, more preferably nucleotides 18611-18661 of SEQ ID NO: 1, most preferably nucleotides 18561-18661 of SEQ ID NO: 1. Intron 1 of a ZNF9 genomic sequence also includes several nucleotide sequences that are highly conserved by intron 1 regions present in different alleles of ZNF9, and preferably are not present elsewhere in the human genome. For instance, an intron 1 of a ZNF9 genomic sequence contains one, preferably two, more preferably 3, most preferably, 4 of the following: GCCGCAGTGCGGGTCGGGTCTGTGGCGGAC (SEQ ID NO:39), the nucleotide sequence generated by using the primers GAGAACCTTGCCATTTTTCG (SEQ ID NO:22) and CACCTACAGCACTGGCAACA (SEQ ID NO:23) to amplify an intron 1 of ZNF9, preferably SEQ ID NO:1, GCCTAGGGGACAAAGTGAGA (SEQ ID NO:10), GGCCTTATAACCATGCAAATG (SEQ ID NO:11), or the complements thereof.

Examples of the polynucleotides of the present invention include polynucleotides located upstream (i.e., 5') or downstream (i.e., 3') of the repeat tract. Polynucleotides of the present invention located upstream of the repeat tract preferably include, in increasing order of preference, about nucleotides 17501-17701 of SEQ ID NO:1, about nucleotides 17101-17701 of SEQ ID NO:1, about nucleotides 16701-17701 of SEQ ID NO:1, most preferably, about nucleotides 15701-17701 of SEQ ID NO:1, or the complements thereof. Polynucleotides of the present invention located downstream of the repeat tract preferably include, in increasing order of preference, about nucleotides 17858-18058 of SEQ ID NO:1, about nucleotides 17858-18458 of SEQ ID NO:1, about nucleotides 17858-18858 of SEQ ID NO:1, most preferably, about nucleotides 17858-19858 of SEQ ID NO:1, or the complements thereof.

Optionally and preferably, the polynucleotides of the invention that include a portion of SEQ ID NO:1 further include a repeat tract, or the complements thereof. More preferably, the polynucleotides of the invention include the repeat tract and polynucleotides located upstream and downstream of the repeat tract. The upstream nucleotide of such polynucleotides can begin at, in increasing order of preference, about nucleotide 17501, about nucleotide 17101, about nucleotide 16701, most preferably, about nucleotide 15701 of SEQ ID NO:1. The downstream nucleotide of such polynucleotides can end at, in increasing order of preference, about nucleotide 18058, about nucleotide 18458, about nucleotide 18858, most preferably, about nucleotide 19858 of SEQ ID NO:1.

The present invention also includes shorter polynucleotides, also referred to herein as primers and probes. A polynucleotide of this aspect of the invention has a nucleotide sequence that is complementary to a nucleotide sequence of a ZNF9 genomic sequence, or the complement thereof. Preferably, such a polynucleotide includes a nucleotide sequence of the intron 1 that flanks the repeat tract, exon 2, or the complements thereof, and optionally, further includes nucleotides of the repeat tract and the complements thereof. In some embodiments, a polynucleotide of this aspect of the invention includes consecutive nucleotides selected from about nucleotides 15701-16700 of SEQ ID NO:1, about nucleotides 16701-17100 of SEQ ID NO:1, about nucleotides 17101-17500 of SEQ ID NO:1, about nucleotides 17501-17701 of SEQ ID NO:1, about nucleotides 17858-18058 of SEQ ID NO:1, about nucleotides 18059-18458 of SEQ ID NO:1, about nucleotides 18459-18858 of SEQ ID NO:1, about nucleotides 18859-19858 of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or the complements thereof. A polynucleotide of this aspect of the invention includes, in increasing order of preference, at least about 15 consecutive nucleotides, at least about 20 consecutive nucleotides, at least about 25 consecutive nucleotides, at least about 200 nucleotides, at least about 350 nucleotides, most preferably, at least about 500 nucleotides.

Methods

The identification of a genomic sequence that is associated with a disease allows for improved diagnosis of the disease. The present invention discloses that an expansion in the intron 1 of a ZNF9 genomic sequence is associated with the disease myotonic dystrophy type 2 (DM2). The expansion occurs in a TG/TCTG/CCTG repeat tract, also referred to herein as a "repeat tract." A repeat tract begins with at least about 14 consecutive TG nucleotides (i.e., the TG dinucleotide repeated 14 times), followed by at least about 3 consecutive TCTG nucleotides, followed by at least about 4 consecutive CCTG nucleotides. A "normal" repeat tract, also referred to herein as a "not at risk" repeat tract, includes no greater than about 176 nucleotides, more preferably no greater than 164, most preferably, no greater than 154 nucleotides, where the total number of nucleotides is determined by counting from the first nucleotide of the first TG to the last nucleotide of the last CCTG. When greater than 4 consecutive CCTG nucleotides are present in a repeat tract, preferably a normal repeat tract, intervening GCTG and/or TCTG nucleotides may also be present. Examples of normal repeat tracts are depicted at SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4 (see FIG. 2B) and at nucleotides 17702-17857 of SEQ ID NO:1. A ZNF9 genomic sequence containing a normal repeat tract is referred to herein as a "normal allele." As used herein, an "allele" of ZNF9 refers to one of several alternative forms of the nucleotide sequence that occupies the location of the ZNF9 genomic sequence on chromosome 3, position 3q21. An individual with two "normal" or "not at risk" alleles of ZNF9 will not display symptoms of DM2 during his or her lifetime, and is considered to be "not at risk."

An "at risk" repeat tract of a ZNF9 genomic sequence also includes consecutive TG nucleotides, preferably about 16, followed by consecutive TCTG nucleotides, preferably about 9, followed by consecutive CCTG nucleotides. The number of consecutive CCTG nucleotides, also referred to herein as "a CCTG repeat," is at least about 75 (i.e., the four nucleotides CCTG repeated at least about 75 times), more preferably at least about 100, most preferably, at least about 500. Typically, a CCTG repeat of an at risk allele is uninterrupted in that there are no other nucleotides present in the CCTG repeat. An example of an at risk repeat tract is depicted at SEQ ID NO:5 (see FIG. 2B). As used herein, "at risk" describes an individual having an allele of the ZNF9 genomic sequence that is associated with DM2. Herein, this includes an individual who may be manifesting at least one symptom of DM2, as well as an individual who may develop at least one symptom of DM2 in the future. An allele of the ZNF9 genomic sequence that is associated with DM2 is referred to herein as an "at risk allele." This mutation is dominant, thus an individual with an at risk allele of ZNF9 may display at least one symptom of DM2 during his or her lifetime. Typically, individuals have either two normal alleles or one normal allele and one at risk allele.

The present invention includes methods for detecting a polynucleotide including a repeat tract within an intron 1 of a ZNF9 genomic sequence, methods for identifying an individual not at risk for developing DM2, and methods for identifying an individual that has or is at risk for developing DM2. The methods of the present invention can involve known methods for detecting a specific polynucleotide, including detection of DNA or RNA, preferably, DNA. For instance, polymerase chain reaction (PCR) techniques can be used with primers that amplify all or a portion of a repeat tract. Alternatively, Southern blotting hybridization techniques using labeled probes can be used. The source of polynucleotides is a biological sample that includes genomic DNA and/or unprocessed RNA, preferably genomic DNA. As used herein, a "biological sample" refers to a sample of material (solid or fluid) obtained from an individual, including but not limited to, for example, blood, plasma, serum, or tissue. An individual can be a rat, mouse, human, chimpanzee, or gorilla, preferably human. Typically, the number of nucleotides in a repeat tract, including the number of CCTG repeats in a repeat tract, can be inferred by the approximate molecular weight of the detected polynucleotide containing the repeat tract. Other techniques, including nucleic acid sequencing, can also be used for determining the number of nucleotides in a repeat tract.

The present invention provides methods for detecting a polynucleotide including at least a portion of a repeat tract within an intron 1 of a ZNF9 genomic sequence. Preferably, the polynucleotide includes an entire repeat tract within an intron 1 of a ZNF9 genomic sequence. In one aspect, the method includes amplifying nucleotides within an intron 1 region of a ZNF9 genomic sequence of an individual to form amplified polynucleotides that include a repeat tract, and detecting the amplified polynucleotides. Preferably, nucleotides are amplified by PCR. In PCR, a molar excess of a primer pair is added to a biological sample that includes polynucleotides, preferably genomic DNA. The primers are extended to form complementary primer extension products which act as template for synthesizing the desired amplified polynucleotides. As used herein, the term "primer pair" means two oligonucleotides designed to flank a region of a polynucleotide to be amplified. One primer is complementary to nucleotides present on the sense strand at one end of a polynucleotide to be amplified and another primer is complementary to nucleotides present on the antisense strand at the other end of the polynucleotide to be amplified. The polynucleotide to be amplified can be referred to as the template polynucleotide. The nucleotides of a polynucleotide to which a primer is complementary is referred to as a target sequence. A primer can have at least about 15 nucleotides, preferably, at least about 20 nucleotides, most preferably, at least about 25 nucleotides. Typically, a primer has at least about 95% sequence identity, preferably at least about 97% sequence identity, most preferably, about 100% sequence identity with the target sequence to which the primer hybridizes. The conditions for amplifying a polynucleotide by PCR vary depending on the nucleotide sequence of primers used, and methods for determining such conditions are routine in the art.

The methods that include amplifying nucleotides within an intron 1 region of a ZNF9 genomic sequence may be used to identify an individual not at risk for developing DM2. In this aspect, the primer pair includes primers that flank a repeat tract. The first primer includes at least about 15 consecutive nucleotides selected from about nucleotides 17501-17701 of SEQ ID NO:1, about nucleotides 17101-17701 of SEQ ID NO:1, about nucleotides 16701-17701 of SEQ ID NO:1, most preferably, about nucleotides 15701-17701 of SEQ ID NO:1. The second primer includes at least about 15 consecutive nucleotides selected from the complement of about nucleotides 17858-18058 of SEQ ID NO:1, about nucleotides 17858-18458 of SEQ ID NO:1, about nucleotides 17858-18858 of SEQ ID NO:1, most preferably, about nucleotides 17858-19858 of SEQ ID NO:1. In a preferred embodiment of this aspect of the invention, one primer includes the nucleotide sequence GGCCTTATAACCATGCAAATG (SEQ ID NO:11) and the second primer includes the nucleotide sequence GCCTAGGGGACAAAGTGAGA (SEQ ID NO:10).

After amplification, the sizes of the amplified polynucleotides may be determined, for instance by gel electrophoresis, and compared. The amplified polynucleotides can be visualized by staining (e.g., with ethidium bromide) or labeling with a suitable label known to those skilled in the art, including radioactive and nonradioactive labels. Typical radioactive labels include .sup.33 P. Nonradioactive labels include, for example, ligands such as biotin or digoxigenin as well as enzymes such as phosphatase or peroxidases, or the various chemiluminescers such as luciferin, or fluorescent compounds like fluorescein and its derivatives.

Due to the size of the expansion of CCTG repeats in an at risk allele, this method of amplifying nucleotides within an intron 1 region of a ZNF9 genomic sequence typically does not result in detectable amplified polynucleotides from an at risk allele. Thus, when the comparison of the sizes of the amplified polynucleotides indicates the presence of two polynucleotides, both copies of the individual's repeat tracts were amplified and the individual is considered to be not at risk (see, for instance, FIG. 6B, lane 1). When only one amplified polynucleotide is present after amplification as described above, it is not possible to conclude that the individual is not at risk (see, for instance, FIG. 6B, lanes 2 and 3).

Instead of comparing the sizes of the amplified polynucleotides after amplification, the size of the repeat tracts of the amplified polynucleotides may be determined by, for instance, inferring the size of the repeat tract based on the observed molecular weight of the amplified polynucleotides, or by determining the nucleotide sequence of the repeat tract. The presence of repeat tracts having no greater than 176 nucleotides, and no repeat tract having at least about 75 CCTG repeats, indicates the individual is not at risk. The presence of a repeat tract having at least about 75 CCTG repeats indicates the individual is at risk.

Alternatively, the methods that include amplifying nucleotides within an intron 1 region of a ZNF9 genomic sequence may be used to identify an individual that has or is at risk for developing DM2. In this aspect, the primer pair includes a first primer having a target sequence that does not include the repeat tract. The first primer includes at least about 15 consecutive nucleotides located either upstream or downstream of a repeat tract. When selected from nucleotides upstream of a repeat tract, the nucleotides are, in increasing order of preference, about nucleotides 17501-17701 of SEQ ID NO:1, about nucleotides 17101-17701 of SEQ ID NO:1, about nucleotides 16701-17701 of SEQ ID NO:1, most preferably, about nucleotides 15701-17701 of SEQ ID NO:1. When selected from nucleotides downstream of a repeat tract, the nucleotides are, in increasing order of preference, the complement of about nucleotides 17858-18058 of SEQ ID NO:1, about nucleotides 17858-18458 of SEQ ID NO:1, about nucleotides 17858-18858 of SEQ ID NO:1, most preferably, about nucleotides 17858-19858 of SEQ ID NO:1. The second primer of the primer pair includes either (CCTG).sub.n or (CAGG).sub.n, where n is at least 4, preferably, at least 5. The second primer binds randomly at multiple sites within a repeat tract, which results in amplified polynucleotides that vary in size but are larger than the amplified polynucleotides that contain a normal allele. Thus, after determining the sizes of the amplified polynucleotides, the presence of one amplified polynucleotide and a population of amplified polynucleotides having a range of sizes that are greater than the one amplified polynucleotide indicates the individual has an at risk allele, and is considered to be at risk (see FIG. 6D and Example 2).


__________________
This is a disease that will be conquered one day!!
godoggo3
Super Member
Registered: 08/31/07
Posts: 43

    08/04/09 at 06:08 AM
Reply with quote#12

One of the reasons that the 177 may be used by Athena diagnostics relates to claim 3 of the patent. The inventors work at the Univ of Minn which is a pioneer in the work of DM2, so there is a lot of validity to this work.

Claim 3 of patent #6,902,896
3. A method for identifying an individual not at risk for developing myotonic dystrophy type 2 (DM2), the method comprising: analyzing intron 1 regions of ZNF9 genomic sequences of an individual for two not at risk alleles comprising repeat tracts of no greater than about 176 nucleotides, wherein an individual comprising two alleles comprising repeat tracts of no greater than about 176 nucleotides is not at risk for developing DM2.



__________________
This is a disease that will be conquered one day!!
godoggo3
Super Member
Registered: 08/31/07
Posts: 43

    08/04/09 at 06:15 AM
Reply with quote#13

Here is the commercial interest information that relates to the 6,902,896 patent. From the University of Minnesota site:

Licensing Technologies and Interacting with Companies

and Other Institutions

 

How are royalties divided?

Through the Office for Technology Commercialization, the University pays to patent, copyright, and/or trademark inventions, and to license them to companies in return for royalty payments on resulting products. After recovering any out-of-pocket costs from the gross licensing proceeds, net proceeds from royalties are divided according to University policy among the inventors, their college, and the technology commercialization program.

33-1/3% to University
33-1/3% to creator or creators
8% to creator's college or school
25-1/3% to creator's department, division, or center to be spent in
support of the creator's research or other directly related University work



__________________
This is a disease that will be conquered one day!!
RPittsley
Super Member
Registered: 07/03/08
Posts: 26

    08/04/09 at 07:33 AM
Reply with quote#14

This is very interesting.  I live in Minnesota and myself and all siblings, nieces, nephews, father, aunts, uncles and cousins are part of the research going on there for DM1.  They may have an "official" cutoff for the CTG count, however, personal experience has shown our family that even lower CTG counts experience symptoms.  My sister with a CTG count of 94 is currently on several medications for pain and spacicity and is almost as disabled as my sisters that are actually on disability.  I have a CTG count of 87.  My doctor recently signed paperwork for a handicapped parking permit because my feet and hips have gotten so bad.  Even on anti-spasm medication my muscles constantly "twitch."  I have pretty severe gastrointestinal problems and I just got a CPAP for sleep apnea.

Three years ago when I took my girls in to the University of Minnesota to see Dr. John Day for an evaluation, he ran them through a bunch of physical tests.  He told me he was very sure that they did not have DM1.  I told him that as a child no one would have diagnosed me with it either, even though in retrospect I had a lot of mild, preliminary symptoms.  He then ran a physical test on me and said that if he did not know that I was positive due to a blood test, that he would say I didn't have it either.  The only place that he was able to detect any myotonia was in the muscle in my palm, under my thumb on my right hand.  He went ahead and did the DNA test on my girls based on my positive blood test. 

Two months later I was contacted with the result:  385 repeats each (identical twins).  I was devastated, but having that diagnosis has really helped in getting my girls the help they need (and I need).  And that muscle in my palm with mild myotonia, it now twitches and contracts almost non-stop.  At this point it doesn't hurt, but it is very annoying and sometimes makes it difficult to type.
godoggo3
Super Member
Registered: 08/31/07
Posts: 43

    08/07/09 at 06:33 AM
Reply with quote#15

This sometimes gets a little confusing. The information posted on this message thread was on DM2 which is distinct from DM1. The CTG repeats start much lower for DM1. The question here is that there seems to be some clinical data that indicates that DM2 cases may have lower repeat amounts such as was posted as the normal cutoff by Athena Diagnostics which apparently has licensed the patent. The patent and Athena diagnostics for the DM2 case indicates that 176 is posted as the cutoff point for potential normal amount of repeats.

There is also a chance that patent law and financial interests may bear to some degree on the Athena cutoff points. This is unsure; and the researchers are of high caliber here. We are continuing to investigate.

__________________
This is a disease that will be conquered one day!!
Previous Thread | Next Thread
Reply

 
Bookmarks
 
Digg Diggdel.icio.us del.icio.usStumbleUpon StumbleUponGoogle Google